zgc:101814

Ensembl ID:
ENSDARG00000004727
ZFIN ID:
ZDB-GENE-041010-146
Description:
Uncharacterized protein C3orf26 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5XJK9]
Human Orthologue:
C3orf26
Human Description:
chromosome 3 open reading frame 26 [Source:HGNC Symbol;Acc:28666]
Mouse Orthologue:
2610528E23Rik
Mouse Description:
RIKEN cDNA 2610528E23 gene Gene [Source:MGI Symbol;Acc:MGI:1913747]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34669 Essential Splice Site Mutation detected in F1 DNA During 2018
sa27413 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020743 Essential Splice Site 152 292 5 9
Genomic Location (Zv9):
Chromosome 9 (position 31023545)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30179491
GRCz11 9 29990237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGCTGTAATGACCTCACACACAGCTTGTCTTCCTACCTCAAAGAAGG[T/C]AAATGCTTTATATGGACACCGTTTTTCTTTTTATATACTCTCTTAGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020743 Nonsense 257 292 8 9
Genomic Location (Zv9):
Chromosome 9 (position 31025641)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30181587
GRCz11 9 29992333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAAGGACTACGTTATCTGGTGCTGGACTGGAACTACAGAGACCAGAAG[C/T]AAAGGAGGATGGTGGATGTACCAGAGGTGCTGTCTGCAAATGGGGCACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link