
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
foigr
- Ensembl ID:
- ENSDARG00000004726
- ZFIN ID:
- ZDB-GENE-030131-1723
- Description:
- UPF0636 protein C4orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1RLX4]
- Human Orthologue:
- C4orf41
- Human Description:
- chromosome 4 open reading frame 41 [Source:HGNC Symbol;Acc:25751]
- Mouse Orthologue:
- D030016E14Rik
- Mouse Description:
- RIKEN cDNA D030016E14 gene Gene [Source:MGI Symbol;Acc:MGI:2444585]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22424 | Nonsense | Available for shipment | Available now |
sa30977 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa22424
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054809 | Nonsense | 693 | 1132 | 20 | 30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 7305894)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 7031373 GRCz11 14 7337782 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTGTCTGGTTTTGTCTTTCAGATCACCAGTGTGGGACTAATGTTAGGT[C/T]GAGAAACGGGCCGTTATGTTTATCTGAATTGGCGGGGCGGTTGGGGAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30977
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000054809 | Essential Splice Site | 898 | 1132 | 24 | 30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 7303714)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 7029193 GRCz11 14 7335602 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGAAACGGTTGTTCCCTTTGAAGTGGCTATGAAGTTTGTGTCCAGTAAG[G/A]TAAGAGGTTTCACTTGGGAGATTTCGGTAATGAAAATCCGTAGTCGTTTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: