zgc:101810

Ensembl ID:
ENSDARG00000004658
ZFIN ID:
ZDB-GENE-041121-7
Description:
actin-related protein 2 [Source:RefSeq peptide;Acc:NP_001007773]
Human Orthologue:
ACTR2
Human Description:
ARP2 actin-related protein 2 homolog (yeast) [Source:HGNC Symbol;Acc:169]
Mouse Orthologue:
Actr2
Mouse Description:
ARP2 actin-related protein 2 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1913963]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20859 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012637 Nonsense 106 394 3 8
Genomic Location (Zv9):
Chromosome 7 (position 8218978)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 7157561
GRCz11 7 7390930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACCACACCTTCGGTCCGCAGCGGCTCAACATCAGCCCTCCCGACTGC[A/T]AGGTGCTGCTGACGGAGCCGCCCATGAACCCTATGAAGAACCGGCAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link