spice1

Ensembl ID:
ENSDARG00000004647
ZFIN ID:
ZDB-GENE-041212-64
Description:
spindle and centriole associated protein 1 [Source:RefSeq peptide;Acc:NP_001008636]
Human Orthologue:
SPICE1
Human Description:
spindle and centriole associated protein 1 [Source:HGNC Symbol;Acc:25083]
Mouse Orthologue:
Ccdc52
Mouse Description:
coiled-coil domain containing 52 Gene [Source:MGI Symbol;Acc:MGI:1196252]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12085 Essential Splice Site Available for shipment Available now
sa10127 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012653 Essential Splice Site 364 724 10 18
ENSDART00000012653 Essential Splice Site 364 724 10 18
Genomic Location (Zv9):
Chromosome 24 (position 21946680)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21193659
GRCz11 24 21338775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGWGGCTCTACTGACAACACTCAGGCGTCTGACCAGCCATATCAAAAAAG[T/C]GAGGGCTCATGTGAGTGCTTTTCCAATCTATTTTTTTTTACTTGATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012653 Essential Splice Site 364 724 10 18
ENSDART00000012653 Essential Splice Site 364 724 10 18
Genomic Location (Zv9):
Chromosome 24 (position 21946680)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21193659
GRCz11 24 21338775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGWGGCTCTACTGACAACACTCAGGCGTCTGACCAGCCATATCAAAAAAG[T/C]GAGGGCTCATGTGAGTGCTTTTCCAATCTATTTTTTTTTACTTGATCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link