si:dkey-263o8.2

Ensembl ID:
ENSDARG00000004627
ZFIN ID:
ZDB-GENE-091204-114
Human Orthologue:
PANX3
Human Description:
pannexin 3 [Source:HGNC Symbol;Acc:20573]
Mouse Orthologue:
Panx3
Mouse Description:
pannexin 3 Gene [Source:MGI Symbol;Acc:MGI:1918881]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12358 Nonsense Available for shipment Available now
sa10093 Nonsense Available for shipment Available now
sa34934 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027288 Nonsense 80 444 2 5
ENSDART00000146116 Nonsense 80 444 3 6
Genomic Location (Zv9):
Chromosome 10 (position 32019738)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31121087
GRCz11 10 31007427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATTAGCTGCTTTCCTCCCAATAACTTCACAGTGAAGCAGGCARCCTA[T/A]GTGGACACGTACTGCTGGGACTCGCTCATGCACCAMGAGTTTGACACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027288 Nonsense 131 444 3 5
ENSDART00000146116 Nonsense 131 444 4 6
Genomic Location (Zv9):
Chromosome 10 (position 32017784)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31119133
GRCz11 10 31005473
KASP Assay ID:
2260-3386.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTGGTGATGGCCATGATGATGTACCTGCCGGCTCTRATCTGGCGCTA[T/A]CTGGCAGTCCCCAGCCTGACCTCTGACCTGTTTTTCATCATYGAYGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027288 Nonsense 294 444 4 5
ENSDART00000146116 Nonsense 294 444 5 6
Genomic Location (Zv9):
Chromosome 10 (position 32015261)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 31116610
GRCz11 10 31002950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGCCGTCTATGTGCTGCTGGCTCCTATTGTCCTCTTCAGCCTGCTT[C/T]GATTGTTTTGCTGGGACACCACCTTTCTTTCCCTGTACGAAGTGCTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link