
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ntrk1
- Ensembl ID:
- ENSDARG00000004586
- ZFIN ID:
- ZDB-GENE-980526-118
- Description:
- Tyrosine-protein kinase receptor [Source:UniProtKB/TrEMBL;Acc:B3DGZ3]
- Human Orthologue:
- NTRK1
- Human Description:
- neurotrophic tyrosine kinase, receptor, type 1 [Source:HGNC Symbol;Acc:8031]
- Mouse Orthologue:
- Ntrk1
- Mouse Description:
- neurotrophic tyrosine kinase, receptor, type 1 Gene [Source:MGI Symbol;Acc:MGI:97383]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32109 | Essential Splice Site | Available for shipment | Available now |
sa14939 | Essential Splice Site | Available for shipment | Available now |
sa14955 | Nonsense | Available for shipment | Available now |
sa36252 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32109
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027013 | None | 619 | None | 13 | |
ENSDART00000125908 | Essential Splice Site | 25 | 733 | 2 | 15 |
ENSDART00000128068 | Essential Splice Site | 85 | 782 | 3 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 48906960)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 45876181 GRCz11 16 45842897 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTTTGGGTGGACACACAAAAGAAAGGTTAATGCTTTTCTTGTTTGTTTC[A/T]GGACGATCACAGATTGTGGGTTGGTGTACATCTCTGAAAATGCCTTTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14939
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027013 | Essential Splice Site | 52 | 619 | 2 | 13 |
ENSDART00000125908 | Essential Splice Site | 170 | 733 | 5 | 15 |
ENSDART00000128068 | Essential Splice Site | 230 | 782 | 6 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 48896625)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 45865846 GRCz11 16 45832562 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGACGATCCACTGGAGAACTGAGCRSCTTCGGTCCRGCTGGAYCCTRGAG[G/A]TACATGAGACATCTATGGAAACTGACSATATAAGTATATCACTGGATCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14955
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027013 | Nonsense | 58 | 619 | 3 | 13 |
ENSDART00000125908 | Nonsense | 176 | 733 | 6 | 15 |
ENSDART00000128068 | Nonsense | 236 | 782 | 7 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 48895098)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 45864319 GRCz11 16 45831035 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTCAGACAGTTAAACCTGTACTGTTGTCCACAGCAWGGAATCTKGGGAT[C/A]AACCCTGGAGGTGRTTCTGCACATGAGRAAYGTGTCTTCTGCTGACAACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36252
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027013 | Essential Splice Site | 209 | 619 | 4 | 13 |
ENSDART00000125908 | Essential Splice Site | 327 | 733 | 7 | 15 |
ENSDART00000128068 | Essential Splice Site | 387 | 782 | 8 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 48885930)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 45855151 GRCz11 16 45821867 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTCATGGACAATCCTTTTGATCCCTCTGACCCGGAGGGCATCATCCCTG[G/A]TGAGGGCACTTCATCTAAATTATATTACACCAACTGTGTGGTGCATTGAG
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: