si:dkey-177p2.3

Ensembl ID:
ENSDARG00000004581
ZFIN ID:
ZDB-GENE-041001-122
Description:
protein sel-1 homolog 1 [Source:RefSeq peptide;Acc:NP_001038629]
Human Orthologue:
SEL1L
Human Description:
sel-1 suppressor of lin-12-like (C. elegans) [Source:HGNC Symbol;Acc:10717]
Mouse Orthologue:
Sel1l
Mouse Description:
sel-1 suppressor of lin-12-like (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1329016]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45699 Nonsense Mutation detected in F1 DNA During 2018
sa12845 Nonsense Available for shipment Available now
sa14080 Nonsense Available for shipment Available now
sa13871 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012816 Nonsense 252 776 7 21
Genomic Location (Zv9):
Chromosome 20 (position 27021999)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27093302
GRCz11 20 26992392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCAATTTTTGTTCCCACAGGCACTTGGATTCCTGTATGCTGCAGGAT[T/A]GGGTGTGAACTCAAGTCAGGCAAAGGTATCACCTGATAATTTGTATCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012816 Nonsense 301 776 9 21
Genomic Location (Zv9):
Chromosome 20 (position 27022556)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27093859
GRCz11 20 26992949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGAGGTGTTGGAGTTCCTCAGAGCTGTGAATCTGCTCTCACTCACTA[C/A]AGACTAGTGGCCAATCACGGTAAATCATGTCACATTTCTGTTCCTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012816 Nonsense 569 776 17 21
ENSDART00000012816 Nonsense 569 776 17 21
Genomic Location (Zv9):
Chromosome 20 (position 27027610)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27098913
GRCz11 20 26998003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATGGACTCTGCTCTTATTCAGTATCTCCTGTTGGCAGAACAGGGCTA[T/A]GAGGTTGCACAGAKCAATGTGGCCTTCGTCCTTGATCAAAGTGAGTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13871
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012816 Nonsense 569 776 17 21
ENSDART00000012816 Nonsense 569 776 17 21
Genomic Location (Zv9):
Chromosome 20 (position 27027610)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27098913
GRCz11 20 26998003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATGGACTCTGCTCTTATTCAGTATCTCCTGTTGGCAGAACAGGGCTA[T/A]GAGGTTGCACAGAKCAATGTGGCCTTCGTCCTTGATCAAAGTGAGTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link