
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:194665
- Ensembl ID:
- ENSDARG00000004577
- ZFIN ID:
- ZDB-GENE-080722-38
- Description:
- transmembrane protein 178-like [Source:RefSeq peptide;Acc:NP_001122218]
- Human Orthologue:
- AC005692.1
- Human Description:
- transmembrane protein 178-like [Source:RefSeq peptide;Acc:NP_001182207]
- Mouse Orthologue:
- Gm5567
- Mouse Description:
- predicted gene 5567 Gene [Source:MGI Symbol;Acc:MGI:3647581]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44289 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44289
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026401 | Nonsense | 203 | 297 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 25 (position 20494341)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 19905253 GRCz11 25 20002907 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGACCATTGGCCTTTTAGGATGTTGTTGGGAGCAAGGCCTCATGCATTA[C/A]GTTGCCGGTCTACTCTTTCTAATGGGAGGTATGTGTATTATTTGAAATGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: