zgc:162235

Ensembl ID:
ENSDARG00000004541
ZFIN ID:
ZDB-GENE-070410-46
Description:
hypothetical protein LOC563648 [Source:RefSeq peptide;Acc:NP_001103935]
Human Orthologue:
DNAI2
Human Description:
dynein, axonemal, intermediate chain 2 [Source:HGNC Symbol;Acc:18744]
Mouse Orthologue:
Dnaic2
Mouse Description:
dynein, axonemal, intermediate chain 2 Gene [Source:MGI Symbol;Acc:MGI:2685574]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16386 Nonsense Available for shipment Available now
sa35357 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009319 Nonsense 202 555 6 13
Genomic Location (Zv9):
Chromosome 12 (position 37719580)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 36246304
GRCz11 12 35940559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTAAGTTACAKTAGTGYATTTTGGYTTCCCAATTACAGAAAACAACAAA[C/T]AGCCGGAGATGACCCTGAAATCCRTATCCCCTCTTGTTTGTCTAGAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009319 Essential Splice Site 323 555 8 13
Genomic Location (Zv9):
Chromosome 12 (position 37720272)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 36245612
GRCz11 12 35939867
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTAACAATGCATTTGGTGCATTCTCAATGGAGTTTGACAACACTATGG[T/A]AATAAAATAGTACATGTCTCATTGTGATTTGGACAATTCCATTGTGGTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link