zgc:173742

Ensembl ID:
ENSDARG00000004529
ZFIN ID:
ZDB-GENE-030131-6489
Human Orthologue:
TOP1
Human Description:
topoisomerase (DNA) I [Source:HGNC Symbol;Acc:11986]
Mouse Orthologue:
Top1
Mouse Description:
topoisomerase (DNA) I Gene [Source:MGI Symbol;Acc:MGI:98788]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44884 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006628 Essential Splice Site 254 735 8 19
Genomic Location (Zv9):
Chromosome 18 (position 13881033)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 14326451
GRCz11 18 14294963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCACCAAAGAGGTCTTCCGCAATAACTTCTTCAAGGACTGGAGGAAG[G/A]TAAGCCCAGCTCAATCTCGTAACCAGTAGCTTTTACAGTTAACGCGTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link