
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
atat1
- Ensembl ID:
- ENSDARG00000004472
- ZFIN ID:
- ZDB-GENE-040426-2120
- Description:
- Alpha-tubulin N-acetyltransferase [Source:UniProtKB/Swiss-Prot;Acc:Q6PH17]
- Human Orthologue:
- ATAT1
- Human Description:
- alpha tubulin acetyltransferase 1 [Source:HGNC Symbol;Acc:21186]
- Mouse Orthologue:
- Atat1
- Mouse Description:
- alpha tubulin acetyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1913869]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9581 | Nonsense | Available for shipment | Available now |
sa12225 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9581
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049368 | Nonsense | 80 | 305 | 3 | 11 |
ENSDART00000103922 | Nonsense | 80 | 297 | 3 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 27969934)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 27900046 GRCz11 19 27484269 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAAAGCTCCAGGCCAACAGACATCATCTCTACCTCCTGAAAGATGGAGAA[C/T]AGAACGGGTAMARTAGCTTTCTCTTTCTCCCCCACCCCATGCTTCAGATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12225
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049368 | Essential Splice Site | 139 | 305 | 5 | 11 |
ENSDART00000103922 | Essential Splice Site | 139 | 297 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 19 (position 27970395)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 27900507 GRCz11 19 27484730 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTACAAAGACATGGCTATGGCTCAGAGCTCTTCGACTTCATGCTRAAAG[T/C]GAGTYGTACGCATGATTTGTTGAATTACATGTGATTTTTACACAAWGTAR
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: