tardbpl

Ensembl ID:
ENSDARG00000004452
ZFIN ID:
ZDB-GENE-031030-1
Description:
TAR DNA binding protein, like [Source:RefSeq peptide;Acc:NP_938178]
Human Orthologue:
TARDBP
Human Description:
TAR DNA binding protein [Source:HGNC Symbol;Acc:11571]
Mouse Orthologue:
Tardbp
Mouse Description:
TAR DNA binding protein Gene [Source:MGI Symbol;Acc:MGI:2387629]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39415 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027255 Nonsense 257 303 5 7
ENSDART00000126681 Nonsense 252 298 5 7
ENSDART00000141928 Nonsense 85 131 3 4

The following transcripts of ENSDARG00000004452 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 29603123)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29433690
GRCz11 23 29360231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTCCTCCAGGTTGCCCAGTCTCTGTGCGGCGAGGACCTGATCATT[A/T]AAGGAACCAGCGTGCACATCTCCAATGCTGAGCCTAAGCACAATAATAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ewing sarcoma: Common variants near TARDBP and EGR2 are associated with susceptibility to Ewing sarcoma. (View Study)
  • Male-pattern baldness: Six novel susceptibility Loci for early-onset androgenetic alopecia and their unexpected association with common diseases. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link