Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
elovl6
- Ensembl ID:
- ENSDARG00000004402
- ZFIN ID:
- ZDB-GENE-030114-1
- Description:
- Elongation of very long chain fatty acids protein 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6PC64]
- Human Orthologue:
- ELOVL6
- Human Description:
- ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) [Sour
- Mouse Orthologue:
- Elovl6
- Mouse Description:
- ELOVL family member 6, elongation of long chain fatty acids (yeast) Gene [Source:MGI Symbol;Acc:MGI:
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa35729 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35729
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000105602 | Nonsense | 2 | 266 | 1 | 4 |
The following transcripts of ENSDARG00000004402 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 14 (position 37467219)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 35906546 GRCz11 14 36246860 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGGCTCACGTTCTTCAGTAAGCGTTCAGAGGACCACCAGAGACCATGT[C/A]GGTGCTGGCATTGCAAGAATACGAATTCGAGAGGCAGTTCAATGAAGATG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Attention deficit hyperactivity disorder: Family-based genome-wide association scan of attention-deficit/hyperactivity disorder. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
