
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rdbp
- Ensembl ID:
- ENSDARG00000004343
- ZFIN ID:
- ZDB-GENE-040718-69
- Description:
- negative elongation factor E [Source:RefSeq peptide;Acc:NP_001002375]
- Human Orthologue:
- RDBP
- Human Description:
- RD RNA binding protein [Source:HGNC Symbol;Acc:13974]
- Mouse Orthologue:
- Rdbp
- Mouse Description:
- RD RNA-binding protein Gene [Source:MGI Symbol;Acc:MGI:102744]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13558 | Essential Splice Site | Available for shipment | Available now |
sa29220 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa13558
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113250 | Essential Splice Site | 57 | 378 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 27409249)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 27339361 GRCz11 19 26923584 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGAAGAYGAAGAAGCGCTGCAAAARAAGTATGCTAAACTGAAGAAAAAG[G/A]TAAAGACGATWGTTACTTTTCTCANNNNATATWTACAYGYACTTTCTAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29220
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113250 | Nonsense | 234 | 378 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 19 (position 27414028)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 27344140 GRCz11 19 26928363 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACGGGACCGGGAACGGGAACGAGACAGGAGCCGGGATGGAGAAAGAGAT[C/T]GAGAGAGGGACCGGGATCGAGACAGAGAACGAGACAGAGAGAGAGATGGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: