
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:158635
- Ensembl ID:
- ENSDARG00000004302
- ZFIN ID:
- ZDB-GENE-070112-2152
- Description:
- hypothetical protein LOC791217 [Source:RefSeq peptide;Acc:NP_001074168]
- Human Orthologue:
- SLC45A1
- Human Description:
- solute carrier family 45, member 1 [Source:HGNC Symbol;Acc:17939]
- Mouse Orthologue:
- Slc45a1
- Mouse Description:
- solute carrier family 45, member 1 Gene [Source:MGI Symbol;Acc:MGI:2653235]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9841 | Nonsense | Available for shipment | Available now |
sa19012 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa41906 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9841
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043016 | None | 148 | None | 4 | |
ENSDART00000102760 | Nonsense | 266 | 802 | 4 | 9 |
ENSDART00000134560 | Nonsense | 266 | 802 | 5 | 10 |
ENSDART00000043016 | None | 148 | None | 4 | |
ENSDART00000102760 | Nonsense | 266 | 802 | 4 | 9 |
ENSDART00000134560 | Nonsense | 266 | 802 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 42133809)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 40393590 GRCz11 11 40657735 - KASP Assay ID:
- 2260-4647.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCGGTGGAGGCTTCGGCTACATAGTGGGTGGCATCAACTGGGACAAAACT[G/T]AGTTCGGAAGGACAATGGGCGGTCAGCTCCGCGTCATATACCTGTTCACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19012
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043016 | None | 148 | None | 4 | |
ENSDART00000102760 | Nonsense | 266 | 802 | 4 | 9 |
ENSDART00000134560 | Nonsense | 266 | 802 | 5 | 10 |
ENSDART00000043016 | None | 148 | None | 4 | |
ENSDART00000102760 | Nonsense | 266 | 802 | 4 | 9 |
ENSDART00000134560 | Nonsense | 266 | 802 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 42133809)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 40393590 GRCz11 11 40657735 - KASP Assay ID:
- 2260-4647.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGGTGGAGGCTTCGGCTACATAGTGGGTGGCATCAACTGGGACAAAACT[G/T]AGTTCGGAAGGACAATGGGCGGTCAGCTCCGCGTCATATACCTGTTCACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41906
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043016 | None | 148 | None | 4 | |
ENSDART00000102760 | Nonsense | 490 | 802 | 4 | 9 |
ENSDART00000134560 | Nonsense | 490 | 802 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 42134481)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 40394262 GRCz11 11 40658407 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCGTTGCAGGCCGATGAGCAAAAACAAGCCATTGAGCCTGACGAGCAG[C/T]AGAATGAAGCTGCGGCAGGCTCTCAGAGAGGCAGTAGCTCAGGGATATTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined): Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. (View Study)
- Breast cancer: A genome-wide scan for breast cancer risk haplotypes among African American women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: