zgc:158635

Ensembl ID:
ENSDARG00000004302
ZFIN ID:
ZDB-GENE-070112-2152
Description:
hypothetical protein LOC791217 [Source:RefSeq peptide;Acc:NP_001074168]
Human Orthologue:
SLC45A1
Human Description:
solute carrier family 45, member 1 [Source:HGNC Symbol;Acc:17939]
Mouse Orthologue:
Slc45a1
Mouse Description:
solute carrier family 45, member 1 Gene [Source:MGI Symbol;Acc:MGI:2653235]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9841 Nonsense Available for shipment Available now
sa19012 Nonsense Mutation detected in F1 DNA During 2018
sa41906 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043016   None 148 None 4
ENSDART00000102760 Nonsense 266 802 4 9
ENSDART00000134560 Nonsense 266 802 5 10
ENSDART00000043016   None 148 None 4
ENSDART00000102760 Nonsense 266 802 4 9
ENSDART00000134560 Nonsense 266 802 5 10
Genomic Location (Zv9):
Chromosome 11 (position 42133809)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40393590
GRCz11 11 40657735
KASP Assay ID:
2260-4647.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGTGGAGGCTTCGGCTACATAGTGGGTGGCATCAACTGGGACAAAACT[G/T]AGTTCGGAAGGACAATGGGCGGTCAGCTCCGCGTCATATACCTGTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043016   None 148 None 4
ENSDART00000102760 Nonsense 266 802 4 9
ENSDART00000134560 Nonsense 266 802 5 10
ENSDART00000043016   None 148 None 4
ENSDART00000102760 Nonsense 266 802 4 9
ENSDART00000134560 Nonsense 266 802 5 10
Genomic Location (Zv9):
Chromosome 11 (position 42133809)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40393590
GRCz11 11 40657735
KASP Assay ID:
2260-4647.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGTGGAGGCTTCGGCTACATAGTGGGTGGCATCAACTGGGACAAAACT[G/T]AGTTCGGAAGGACAATGGGCGGTCAGCTCCGCGTCATATACCTGTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043016   None 148 None 4
ENSDART00000102760 Nonsense 490 802 4 9
ENSDART00000134560 Nonsense 490 802 5 10
Genomic Location (Zv9):
Chromosome 11 (position 42134481)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40394262
GRCz11 11 40658407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGTTGCAGGCCGATGAGCAAAAACAAGCCATTGAGCCTGACGAGCAG[C/T]AGAATGAAGCTGCGGCAGGCTCTCAGAGAGGCAGTAGCTCAGGGATATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link