zgc:73290

Ensembl ID:
ENSDARG00000004297
ZFIN ID:
ZDB-GENE-040426-1968
Description:
enhanced at puberty protein 1 [Source:RefSeq peptide;Acc:NP_997852]
Human Orthologue:
C14orf4
Human Description:
chromosome 14 open reading frame 4 [Source:HGNC Symbol;Acc:14282]
Mouse Orthologue:
6430527G18Rik
Mouse Description:
RIKEN cDNA 6430527G18 gene Gene [Source:MGI Symbol;Acc:MGI:2442463]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42878 Nonsense Mutation detected in F1 DNA During 2018
sa28815 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015418 Nonsense 108 661 1 1
Genomic Location (Zv9):
Chromosome 17 (position 11192974)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11175496
GRCz11 17 11329562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACCATGTGGACGGCTCGTCTAAATCGCAACAGCAGCAGCAGCAGCAA[C/T]AACAACAGTCCGGCTTGGACCGATACGCGCTCGCCACCGAAAGATCACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015418 Nonsense 110 661 1 1
Genomic Location (Zv9):
Chromosome 17 (position 11192968)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 11175490
GRCz11 17 11329556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGGACGGCTCGTCTAAATCGCAACAGCAGCAGCAGCAGCAACAACAA[C/T]AGTCCGGCTTGGACCGATACGCGCTCGCCACCGAAAGATCACGCTTTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link