zgc:77375

Ensembl ID:
ENSDARG00000004282
ZFIN ID:
ZDB-GENE-040426-1827
Description:
hypothetical protein LOC402927 [Source:RefSeq peptide;Acc:NP_991194]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6186 Nonsense Mutation detected in F1 DNA During 2018
sa27698 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005923 Nonsense 81 429 2 8
Genomic Location (Zv9):
Chromosome 11 (position 451956)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 438693
GRCz11 11 465191
KASP Assay ID:
554-5332.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGTTCTTGGTCCCAGTCGTCTTTGTCACAAATGCTGGAAACTGCTTA[C/T]GACAGAAGAAGGCTGATCAGCTGTCRCACATACTGGGTGTTCCTGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005923 Essential Splice Site 176 429 5 8
Genomic Location (Zv9):
Chromosome 11 (position 449039)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 435776
GRCz11 11 462274
KASP Assay ID:
2260-3766.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTGTTGTTTCAGTCTTCTCCTGTGGCGAACCTGCCCAGAGTGGAAGG[T/A]AAGACACTTCAGCACACAACTGCATGTTACTGTGGGATTTACAGCTCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link