zgc:109986

Ensembl ID:
ENSDARG00000004265
ZFIN ID:
ZDB-GENE-050522-136
Description:
hypothetical protein LOC553566 [Source:RefSeq peptide;Acc:NP_001018381]
Mouse Orthologue:
2700097O09Rik
Mouse Description:
RIKEN cDNA 2700097O09 gene Gene [Source:MGI Symbol;Acc:MGI:1919908]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36340 Nonsense Mutation detected in F1 DNA During 2018
sa42876 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025410 Nonsense 151 306 4 8
ENSDART00000146172 Nonsense 151 205 4 5

The following transcripts of ENSDARG00000004265 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10534804)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9910520
GRCz11 17 10066554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCCACAACGTTCTTCCAGAACTCACTGGAAAACTGGTGTTGGATGTG[G/T]GATCAAGACTAGGAGCTGTGCTGTTCGGGGTAAACTGCTGATGATTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025410 Essential Splice Site 266 306 7 8
ENSDART00000146172   None 205 None 5

The following transcripts of ENSDARG00000004265 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10537289)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9908035
GRCz11 17 10064069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGTACCCAGCATTCAGGAGGCACTTGGTTTACTTCAGGATGCTGCTG[T/A]GAGTAACTTTATATCTGATATTACAGAATAAGGGTTCGTCTCACTCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link