zgc:63602

Ensembl ID:
ENSDARG00000004262
ZFIN ID:
ZDB-GENE-040426-1184
Description:
hypothetical protein LOC393433 [Source:RefSeq peptide;Acc:NP_956755]
Human Orthologue:
CYP46A1
Human Description:
cytochrome P450, family 46, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2641]
Mouse Orthologue:
Cyp46a1
Mouse Description:
cytochrome P450, family 46, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1341877]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43377 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057699 Nonsense 208 444 8 15
Genomic Location (Zv9):
Chromosome 20 (position 5284620)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5200213
GRCz11 20 5244620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTAGAGATGCAGCAGTACTCTTGAGGAAAACGGGAGAGAAATGGATA[C/T]AAAACAGGAAGACAGCAGTGAAAAATGGAGAGGACGTCCCCAAAGACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link