
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rnd1l
- Ensembl ID:
- ENSDARG00000004218
- ZFIN ID:
- ZDB-GENE-060315-7
- Description:
- Rho family GTPase 1 like [Source:RefSeq peptide;Acc:NP_001037861]
- Human Orthologue:
- RND1
- Human Description:
- Rho family GTPase 1 [Source:HGNC Symbol;Acc:18314]
- Mouse Orthologue:
- Rnd1
- Mouse Description:
- Rho family GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:2444878]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43993 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43993
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018654 | Nonsense | 144 | 232 | 4 | 5 |
ENSDART00000109712 | None | 87 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 23 (position 27241775)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 27074597 GRCz11 23 27001138 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGACCTTCGGACAGACGTTTGCACACTGATGGAGCTGTCCAATCAGAAA[C/T]AAACCCCCATCACCCATGAGCAGGTACAGCTAGACGTTCACCTATTCAGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: