
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:113313
- Ensembl ID:
- ENSDARG00000004211
- ZFIN ID:
- ZDB-GENE-050220-4
- Description:
- hypothetical protein LOC503526 [Source:RefSeq peptide;Acc:NP_001012508]
- Human Orthologue:
- CCDC106
- Human Description:
- coiled-coil domain containing 106 [Source:HGNC Symbol;Acc:30181]
- Mouse Orthologue:
- Ccdc106
- Mouse Description:
- coiled-coil domain containing 106 Gene [Source:MGI Symbol;Acc:MGI:2385900]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15216 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15216
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000011936 | Nonsense | 29 | 386 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 19718863)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 17749186 GRCz11 16 17653621 - KASP Assay ID:
- 2260-9497.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCTAATCGTTATTCTTTAGCTCCCAAGAATGAGGATACATATGAAATTT[C/A]AATTCCCTTTGAAGACAACAATTTTGAGCAACAAGGAGGTTTTTACAGCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: