zgc:113313

Ensembl ID:
ENSDARG00000004211
ZFIN ID:
ZDB-GENE-050220-4
Description:
hypothetical protein LOC503526 [Source:RefSeq peptide;Acc:NP_001012508]
Human Orthologue:
CCDC106
Human Description:
coiled-coil domain containing 106 [Source:HGNC Symbol;Acc:30181]
Mouse Orthologue:
Ccdc106
Mouse Description:
coiled-coil domain containing 106 Gene [Source:MGI Symbol;Acc:MGI:2385900]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15216 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011936 Nonsense 29 386 3 9
Genomic Location (Zv9):
Chromosome 16 (position 19718863)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17749186
GRCz11 16 17653621
KASP Assay ID:
2260-9497.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTAATCGTTATTCTTTAGCTCCCAAGAATGAGGATACATATGAAATTT[C/A]AATTCCCTTTGAAGACAACAATTTTGAGCAACAAGGAGGTTTTTACAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link