tnfsf10l

Ensembl ID:
ENSDARG00000004196
ZFIN ID:
ZDB-GENE-010801-1
Description:
tumor necrosis factor (ligand) superfamily, member 10 like [Source:RefSeq peptide;Acc:NP_571918]
Human Orthologue:
TNFSF10
Human Description:
tumor necrosis factor (ligand) superfamily, member 10 [Source:HGNC Symbol;Acc:11925]
Mouse Orthologue:
Tnfsf10
Mouse Description:
tumor necrosis factor (ligand) superfamily, member 10 Gene [Source:MGI Symbol;Acc:MGI:107414]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40877 Nonsense Mutation detected in F1 DNA During 2018
sa34054 Essential Splice Site Available for shipment Available now
sa34053 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101447 Nonsense 66 317 1 5
ENSDART00000122113 Nonsense 56 264 1 5

The following transcripts of ENSDARG00000004196 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24123643)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22685395
GRCz11 7 22956552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCGCGTCCACCACGGGGCTCTTTGTCTACTTAAACATGTCTTTATCG[C/T]AGGTGAGACAATGTTTGCACTCTTATTATATCTTTGGGTGAACTTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101447 Essential Splice Site 117 317 3 5
ENSDART00000122113 Essential Splice Site 107 264 3 5

The following transcripts of ENSDARG00000004196 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24089131)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22650883
GRCz11 7 22922040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGTTTTCTCGACTGATGGAAGTGTTTTTGTTTGTTTTTTTGTCACA[G/T]GTTACGGACAGTATCATCTCTAAACAGACTTTACATGGTGAGTAGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101447 Nonsense 137 317 4 5
ENSDART00000122113 Nonsense 127 264 4 5

The following transcripts of ENSDARG00000004196 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24088855)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 22650607
GRCz11 7 22921764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTCTGTCTGTCTGTCCTTCAGCAGCAAGAACACAAACTCATTCATA[T/G]AATACAACAGGGTCAAAGTTTATGACCACAGTGATGCAGCGGCCATCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link