zgc:110366

Ensembl ID:
ENSDARG00000004167
ZFIN ID:
ZDB-GENE-050417-302
Description:
hypothetical protein LOC550476 [Source:RefSeq peptide;Acc:NP_001017779]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32838 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012119 Essential Splice Site 30 289 None 8

The following transcripts of ENSDARG00000004167 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 6837215)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7260785
GRCz11 2 7132391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCGGTACCACTACACAATGGACTGAACATTCCCATTCTGGGTTTGGG[T/C]GAGAACAAACTTATGTGTGGAATATGCATGTAAGTTAGCCATAACGTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012119 Nonsense 76 289 2 8

The following transcripts of ENSDARG00000004167 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 6839265)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7262835
GRCz11 2 7134441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATGGTTGTGAGGAGGCTCTGGGAAAAGCAGTGACTGAGAGTGGAGTA[C/T]AGCGGGAGGAACTCTGGATCACCACCAAACTATGGCCTGGAGATTACGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link