
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
reep3
- Ensembl ID:
- ENSDARG00000004160
- ZFIN ID:
- ZDB-GENE-040426-730
- Description:
- Receptor expression-enhancing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVX5]
- Human Orthologue:
- REEP3
- Human Description:
- receptor accessory protein 3 [Source:HGNC Symbol;Acc:23711]
- Mouse Orthologue:
- Reep3
- Mouse Description:
- receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22035 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22035
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000021628 | Essential Splice Site | 139 | 256 | 5 | 8 |
ENSDART00000127187 | Essential Splice Site | 138 | 255 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome 12 (position 9620370)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 8828325 GRCz11 12 8866168 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACAGGGCCTGACCATCGCTGCAACTGCTGCTGTGTCTGCTGCTGTCAAG[G/A]CAAGTGTGTGTGTGAGTTGAAGATGGACAAACGGAATAAGTTAAAGCTCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Arthritis (juvenile idiopathic): Genome-wide association analysis of juvenile idiopathic arthritis identifies a new susceptibility locus at chromosomal region 3q13. (View Study)
- Liver enzyme levels: Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: