wu:fj52c07

Ensembl ID:
ENSDARG00000004150
ZFIN ID:
ZDB-GENE-030131-8097
Human Orthologue:
GRM2
Human Description:
glutamate receptor, metabotropic 2 [Source:HGNC Symbol;Acc:4594]
Mouse Orthologue:
Grm2
Mouse Description:
glutamate receptor, metabotropic 2 Gene [Source:MGI Symbol;Acc:MGI:1351339]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20787 Nonsense Available for shipment Available now
sa33936 Nonsense Mutation detected in F1 DNA During 2018
sa10180 Nonsense Available for shipment Available now
sa6072 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085472 Nonsense 205 894 2 5
Genomic Location (Zv9):
Chromosome 6 (position 42004143)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42075743
GRCz11 6 42073279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCAGTTATGCCTCCACCAGTGCAAAACTGAGTGACAAATCCCGCTA[T/A]GATTACTTTGCCCGGACTGTACCTCCTGACTTCTACCAAGCCAAAGCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085472 Nonsense 240 894 2 5
Genomic Location (Zv9):
Chromosome 6 (position 42004040)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42075640
GRCz11 6 42073176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGATCCTACGCTTCTTCAACTGGACGTACGTCTCCACTGTGGCCTCA[G/T]AGGGAGATTACGGCGAGACGGGCATCGACGCCTTTCAGCAAGAAGCTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085472 Nonsense 477 894 3 5
Genomic Location (Zv9):
Chromosome 6 (position 41996459)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42068059
GRCz11 6 42065595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGGCYGATACTGATAACATCATTCACTTTGATGCATACGGAGACAGTT[T/A]GGGCCGCTACAACATCTTCCAYTAKCACAAAGAGAATRATGAGTACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085472 Nonsense 485 894 3 5
Genomic Location (Zv9):
Chromosome 6 (position 41996434)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42068034
GRCz11 6 42065570
KASP Assay ID:
554-3797.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTGATGCATACGGAGACAGTTTGGGCCGCTACAACATCTTCCAYTA[T/G]CACAAAGAGAATRATGAGTACGTCTATAGAAAGGTGGGCTACTGGGCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link