zgc:92630

Ensembl ID:
ENSDARG00000004141
ZFIN ID:
ZDB-GENE-040718-449
Description:
hypothetical protein LOC436969 [Source:RefSeq peptide;Acc:NP_001002696]
Human Orthologue:
DHRS11
Human Description:
dehydrogenase/reductase (SDR family) member 11 [Source:HGNC Symbol;Acc:28639]
Mouse Orthologue:
Dhrs11
Mouse Description:
dehydrogenase/reductase (SDR family) member 11 Gene [Source:MGI Symbol;Acc:MGI:2652816]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42507 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35828 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127436 Essential Splice Site 45 255 2 7
Genomic Location (Zv9):
Chromosome 15 (position 14449697)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15494660
GRCz11 15 15430682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGTTCCCTTCATGGAATGTAATTCTCAAAGATCTCTTTTCCTTTTGC[A/C]GAAACTGGCGGCTGAATGTGTCAGTAGCGGATACAGCGGTGCTCTGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127436 Nonsense 233 255 6 7
Genomic Location (Zv9):
Chromosome 15 (position 14450611)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15495574
GRCz11 15 15431596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCATTTACAGTGCCTGCAAGCTGATGACATAACCAATGCAGTGGTGTA[T/A]GTTCTAAGTGCTCCTCCTCACGTCCAAGTAAGCAACGCCAATCACTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link