acsbg2

Ensembl ID:
ENSDARG00000004094
ZFIN ID:
ZDB-GENE-030131-7099
Description:
long-chain-fatty-acid--CoA ligase ACSBG2 [Source:RefSeq peptide;Acc:NP_001119851]
Human Orthologue:
ACSBG2
Human Description:
acyl-CoA synthetase bubblegum family member 2 [Source:HGNC Symbol;Acc:24174]
Mouse Orthologues:
1700061G19Rik, Acsbg2
Mouse Descriptions:
acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI Symbol;Acc:MGI:3587728]
RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44683 Nonsense Mutation detected in F1 DNA During 2018
sa34372 Essential Splice Site Mutation detected in F1 DNA During 2018
sa27178 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012120   None 752 None 15
ENSDART00000123926   None 752 None 15
ENSDART00000124809 Nonsense 36 794 1 15
Genomic Location (Zv9):
Chromosome 8 (position 20695921)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20125818
GRCz11 8 20157903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGCTGGCATTTTAAAACCTCTTGATTCGGAAAAGCCAAAGACAAGG[C/T]AGCGTTTTTCATCCGTGACGATGCACTGTAAGTTTGTGTTTTTGTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012120 Essential Splice Site 48 752 2 15
ENSDART00000123926 Essential Splice Site 48 752 2 15
ENSDART00000124809 Essential Splice Site 90 794 2 15
Genomic Location (Zv9):
Chromosome 8 (position 20704602)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20134499
GRCz11 8 20166584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACAGTCTCGCCTCTCTGGAAGACGCTGCCGCAGAGTCTACAGCAAAG[T/G]CAGTCCCTGTCCAGTACACTTTTGTTTCTTTTTTACTTGGTCAGGCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012120 Essential Splice Site 631 752 13 15
ENSDART00000123926 Essential Splice Site 631 752 13 15
ENSDART00000124809 Essential Splice Site 673 794 13 15
Genomic Location (Zv9):
Chromosome 8 (position 20724504)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20154401
GRCz11 8 20186486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTATAGGAGACAAGAGAAAATTCCTCTCCATGCTGCTTACCGTTAAG[G/A]TACCTTTTCAGATTTGTGTGTTTATGCGTAGAAAACCTGCTGTCAATCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link