acsl4a

Ensembl ID:
ENSDARG00000004078
ZFIN ID:
ZDB-GENE-040426-1565
Description:
long-chain-fatty-acid--CoA ligase 4 [Source:RefSeq peptide;Acc:NP_956943]
Human Orthologue:
ACSL4
Human Description:
acyl-CoA synthetase long-chain family member 4 [Source:HGNC Symbol;Acc:3571]
Mouse Orthologue:
Acsl4
Mouse Description:
acyl-CoA synthetase long-chain family member 4 Gene [Source:MGI Symbol;Acc:MGI:1354713]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35699 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006489 Nonsense 400 706 9 15
Genomic Location (Zv9):
Chromosome 14 (position 29469014)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 28142934
GRCz11 14 28448892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTGCAAGAGATGAGCTGTGTGCAGAGAACCTTGTTCAAGCTGGCCTA[C/A]GACTATAAGCTCGAGCAGATCAAGAAGGGTTATGATGCGCCGCTCTGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link