
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bach2
- Ensembl ID:
- ENSDARG00000004074
- ZFIN ID:
- ZDB-GENE-041001-139
- Description:
- Novel protein similar to human and mouse BTB and CNC homology 1, basic leucine zipper transcription
- Human Orthologue:
- BACH2
- Human Description:
- BTB and CNC homology 1, basic leucine zipper transcription factor 2 [Source:HGNC Symbol;Acc:14078]
- Mouse Orthologue:
- Bach2
- Mouse Description:
- BTB and CNC homology 2 Gene [Source:MGI Symbol;Acc:MGI:894679]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23698 | Nonsense | Available for shipment | Available now |
sa37023 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23698
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028717 | Nonsense | 500 | 823 | 3 | 5 |
ENSDART00000131857 | Nonsense | 473 | 796 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 23979164)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 24097965 GRCz11 20 23997065 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCGCCAAAGGCCCAATACCAGCTGCCCAGTGCCAATTAAGGTATGCCCA[C/T]GATCGCCCCCTTCAGAGACCCGCACTCGGACCTCCAGTTCCTGTTCGTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37023
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028717 | Nonsense | 816 | 823 | 5 | 5 |
ENSDART00000131857 | Nonsense | 789 | 796 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 20 (position 23956751)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 24075552 GRCz11 20 23974652 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGACAGTAGACTTCTGTCAAGAGATGACAGATAAATGTACAACTGACGAA[C/T]AGCCCAACAGAAAGGACTGTACCTAATGACGGTGGTTTCTCTGTGTTGAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
- Cognitive performance: Common genetic variation and performance on standardized cognitive tests. (View Study)
- Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
- Graves' disease: A genome-wide association study identifies two new risk loci for Graves' disease. (View Study)
- IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)
- Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)
- Type 1 diabetes: Follow-up analysis of genome-wide association data identifies novel loci for type 1 diabetes. (View Study)
- Type 1 diabetes: Genome-wide association study and meta-analysis find that over 40 loci affect risk of type 1 diabetes. (View Study)
- Type 1 diabetes: Meta-analysis of genome-wide association study data identifies additional type 1 diabetes risk loci. (View Study)
- Type 1 diabetes autoantibodies: Genome-wide association analysis of autoantibody positivity in type 1 diabetes cases. (View Study)
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
- Vitiligo: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: