galk2

Ensembl ID:
ENSDARG00000004059
ZFIN ID:
ZDB-GENE-041114-143
Description:
galactokinase 2 [Source:RefSeq peptide;Acc:NP_001007433]
Human Orthologue:
GALK2
Human Description:
galactokinase 2 [Source:HGNC Symbol;Acc:4119]
Mouse Orthologue:
Galk2
Mouse Description:
galactokinase 2 Gene [Source:MGI Symbol;Acc:MGI:1917226]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45857 Nonsense Mutation detected in F1 DNA During 2018
sa9081 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012600 Nonsense 64 457 3 10
ENSDART00000103351 Nonsense 64 360 3 11
Genomic Location (Zv9):
Chromosome 25 (position 33369945)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31980347
GRCz11 25 32391304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGCATATTGATTACTGTGGCTATGCTGTCCTGCCGATGGCGATAGAG[C/T]AGAGTATTCTCGCTGCTGTTTCTGTCTCTGACACTAAAACCATCCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012600 Nonsense 76 457 3 10
ENSDART00000103351 Nonsense 76 360 3 11
Genomic Location (Zv9):
Chromosome 25 (position 33369981)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31980383
GRCz11 25 32391340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATGGCGATAGAGCAGAGTATTCTCGCTGCTGTTTCTGTCTCTGACACT[A/T]AAACCATCCAGCTGACAAACACTGACCCCAAATACAAGTGAGTAATTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link