
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
galk2
- Ensembl ID:
- ENSDARG00000004059
- ZFIN ID:
- ZDB-GENE-041114-143
- Description:
- galactokinase 2 [Source:RefSeq peptide;Acc:NP_001007433]
- Human Orthologue:
- GALK2
- Human Description:
- galactokinase 2 [Source:HGNC Symbol;Acc:4119]
- Mouse Orthologue:
- Galk2
- Mouse Description:
- galactokinase 2 Gene [Source:MGI Symbol;Acc:MGI:1917226]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45857 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9081 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45857
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012600 | Nonsense | 64 | 457 | 3 | 10 |
ENSDART00000103351 | Nonsense | 64 | 360 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 25 (position 33369945)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 31980347 GRCz11 25 32391304 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAGCATATTGATTACTGTGGCTATGCTGTCCTGCCGATGGCGATAGAG[C/T]AGAGTATTCTCGCTGCTGTTTCTGTCTCTGACACTAAAACCATCCAGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9081
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012600 | Nonsense | 76 | 457 | 3 | 10 |
ENSDART00000103351 | Nonsense | 76 | 360 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 25 (position 33369981)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 31980383 GRCz11 25 32391340 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGATGGCGATAGAGCAGAGTATTCTCGCTGCTGTTTCTGTCTCTGACACT[A/T]AAACCATCCAGCTGACAAACACTGACCCCAAATACAAGTGAGTAATTCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: