marcksa

Ensembl ID:
ENSDARG00000004049
ZFIN ID:
ZDB-GENE-050522-145
Description:
myristoylated alanine-rich C-kinase substrate [Source:RefSeq peptide;Acc:NP_001019575]
Human Orthologue:
MARCKS
Human Description:
myristoylated alanine-rich protein kinase C substrate [Source:HGNC Symbol;Acc:6759]
Mouse Orthologue:
Marcks
Mouse Description:
myristoylated alanine rich protein kinase C substrate Gene [Source:MGI Symbol;Acc:MGI:96907]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44930 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022702 Nonsense 167 236 2 3
ENSDART00000123096 Nonsense 167 236 2 2
Genomic Location (Zv9):
Chromosome 20 (position 3355660)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3299314
GRCz11 20 3316815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGCCAAGACGGATGGAGCTGTTGAAGGTGTGTCAGAAGAGAAGGCC[C/T]AAACCACAGAGGAGGCGGCCAAAACAGAGCAGAATCCAGTAGAGGAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link