
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cog2
- Ensembl ID:
- ENSDARG00000004037
- ZFIN ID:
- ZDB-GENE-040426-2671
- Description:
- conserved oligomeric Golgi complex subunit 2 [Source:RefSeq peptide;Acc:NP_998519]
- Human Orthologue:
- COG2
- Human Description:
- component of oligomeric golgi complex 2 [Source:HGNC Symbol;Acc:6546]
- Mouse Orthologue:
- Cog2
- Mouse Description:
- component of oligomeric golgi complex 2 Gene [Source:MGI Symbol;Acc:MGI:1923582]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8649 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18123 | Essential Splice Site | Available for shipment | Available now |
sa12307 | Essential Splice Site | Available for shipment | Available now |
sa12578 | Essential Splice Site | Available for shipment | Available now |
sa8564 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8649
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24240587)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 23886247 GRCz11 13 24016697 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTTATTAATAAAGACTATGCAGATTTCGTTAAYCTCTCCACCAATCTTG[T/C]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18123
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24240587)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 23886247 GRCz11 13 24016697 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTTATTAATAAAGACTATGCAGATTTCGTYAAYCTCTCCACCAATCTTG[T/C]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12307
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
ENSDART00000026189 | Essential Splice Site | 74 | 730 | 2 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24240587)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 23886247 GRCz11 13 24016697 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTTATTAATAAAGACTATGCAGATTTCGTYAAYCTCTCCACCAATCTTG[T/A]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12578
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026189 | Essential Splice Site | 295 | 730 | 8 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24234453)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 23880113 GRCz11 13 24010563 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCATCACTGCAGACTTCTGCGAGAGGTGACCGGTGGCGCAATCTCTAGG[T/C]ATGTTTGCCACTCACATAAAACTTTTACAGCATTGAGCCATTGTWGTCAR
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8564
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026189 | Essential Splice Site | 455 | 730 | 12 | 18 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24226996)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 23872656 GRCz11 13 24003106 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAACTCAYTCTGCAGCTCATCTCCAGATACTCCACCTTTCTTACCGAGG[T/C]AATGCATTYCAGCTGAGAGGAATTTGAATCATAATAATAGAGTTATTGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: