zgc:114108

Ensembl ID:
ENSDARG00000003973
ZFIN ID:
ZDB-GENE-050626-79
Description:
cysteine and histidine-rich domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001020346]
Human Orthologue:
CHORDC1
Human Description:
cysteine and histidine-rich domain (CHORD)-containing 1 [Source:HGNC Symbol;Acc:14525]
Mouse Orthologue:
Chordc1
Mouse Description:
cysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1 Gene [Source:MGI Symbo

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9389 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041249 Essential Splice Site 264 339 9 11
Genomic Location (Zv9):
Chromosome 15 (position 42761832)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43939988
GRCz11 15 43963431
KASP Assay ID:
2260-8997.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAACTCCAACCCGCAGCTCTGCTCTGTGGAGGCCAACAGCGTCTCGG[T/G]CAGTGTGTTTATCTGATTAAAGAGATWATTTYTTTCTAAAYGTGCWAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link