zgc:162969

Ensembl ID:
ENSDARG00000003968
ZFIN ID:
ZDB-GENE-041008-244
Description:
La ribonucleoprotein domain family, member 6 [Source:RefSeq peptide;Acc:NP_001082877]
Human Orthologue:
LARP6
Human Description:
La ribonucleoprotein domain family, member 6 [Source:HGNC Symbol;Acc:24012]
Mouse Orthologue:
Larp6
Mouse Description:
La ribonucleoprotein domain family, member 6 Gene [Source:MGI Symbol;Acc:MGI:1914807]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13430 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004483 Nonsense 249 471 4 4
ENSDART00000134957 Nonsense 157 207 3 3
ENSDART00000137879   None 134 None 3
Genomic Location (Zv9):
Chromosome 11 (position 6529745)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6437239
GRCz11 11 6447078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATCTGGAGGGCGCTCGCAAAGCTTWTGAAGCCCTGAAGGTGGAAGAG[C/T]AGCAGGGAGGTCGGGGCATTTGTGTGGTCCTGCTGGGCAGCCGTGGAACM
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Proinsulin levels: Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link