zgc:153454

Ensembl ID:
ENSDARG00000003910
ZFIN ID:
ZDB-GENE-030131-3529
Description:
Mediator of RNA polymerase II transcription subunit 13-like [Source:UniProtKB/Swiss-Prot;Acc:A2VCZ5]
Human Orthologue:
MED13
Human Description:
mediator complex subunit 13 [Source:HGNC Symbol;Acc:22474]
Mouse Orthologue:
Med13
Mouse Description:
mediator complex subunit 13 Gene [Source:MGI Symbol;Acc:MGI:3029632]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22623 Nonsense Available for shipment Available now
sa22622 Nonsense Available for shipment Available now
sa35864 Essential Splice Site Available for shipment Available now
sa28439 Nonsense Available for shipment Available now
sa12757 Nonsense Available for shipment Available now
sa30993 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32028 Nonsense Available for shipment Available now
sa35863 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 220 2102 5 30
Genomic Location (Zv9):
Chromosome 15 (position 19062355)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20164981
GRCz11 15 20100713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTACAGTCATCCTCTCTCCGTATGGTCTGAGCGGGACTCTGACGGGC[C/T]AGTCCTTCAAGCTCTCGGATCCACCAACCCAGAAGCTAATCGAGGAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 236 2102 5 30
Genomic Location (Zv9):
Chromosome 15 (position 19062305)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20164931
GRCz11 15 20100663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCCTTCAAGCTCTCGGATCCACCAACCCAGAAGCTAATCGAGGAATG[G/A]AAGCAGTTTTATCCCATCGGCCCCAACACCAAAGAGGTCACAGACGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Essential Splice Site 390 2102 7 30
Genomic Location (Zv9):
Chromosome 15 (position 19059170)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20161796
GRCz11 15 20097528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGAGCGAGTCTGGCAGGAGTGCAATATTAACCGAGCACAGAACAAG[T/C]AAGAATGTAAAATCTACATCATGACTGATTAGCCAGAGCAAATAACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 432 2102 9 30
Genomic Location (Zv9):
Chromosome 15 (position 19056810)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20159436
GRCz11 15 20095168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATAACATTTCTATCTTTCATTTTTCATTCCAGGCTTAAAAACCAGAAA[C/T]AGCGGGCATGTAGCACCCCAGGGCATCCTCCATCTGCTGGCCAGCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12757
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 484 2102 9 30
Genomic Location (Zv9):
Chromosome 15 (position 19056654)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20159280
GRCz11 15 20095012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAGGCCGCTGACGCCCTTCCACCACCGCAGCTCTCWGTGTGAAGAA[C/T]AACCCAGCTTGGAGCAGGGAGAGAGCGTTCACCGACTGTGTCTGCAGGGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Essential Splice Site 1373 2102 19 30
Genomic Location (Zv9):
Chromosome 15 (position 19036281)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20138907
GRCz11 15 20074639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATAAAAGACTATAGAAATAAATGTGACTTGATTGATTATTGTTTGGCA[G/A]TCTTGTCGGCTTGGTCAGCACAGGCCCATTGCCAAGTCTCACGCTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Nonsense 1652 2102 22 30
Genomic Location (Zv9):
Chromosome 15 (position 19032998)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20135624
GRCz11 15 20071356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGTACTTGCTGCAGCCGGTCTGGAGTGAGGAGCGCCATATATATGCA[C/T]AGCACCTGAAGTCTTTGGCTTTCTCAGTTTACACACAGTGCAGACGGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110267 Essential Splice Site 1870 2102 25 30
Genomic Location (Zv9):
Chromosome 15 (position 19028495)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20131121
GRCz11 15 20066853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGTCTAGTTGCCATGGAACCACAGGCTTCCTTTGTAATCATGCCAG[G/A]TAATTAATGTGGCGCTTTCACACAGAGCACTTGTACTTTGTCATTGTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link