zdhhc23

Ensembl ID:
ENSDARG00000003899
ZFIN ID:
ZDB-GENE-040808-13
Description:
probable palmitoyltransferase ZDHHC23 [Source:RefSeq peptide;Acc:NP_001003757]
Human Orthologue:
ZDHHC23
Human Description:
zinc finger, DHHC-type containing 23 [Source:HGNC Symbol;Acc:28654]
Mouse Orthologue:
Zdhhc23
Mouse Description:
zinc finger, DHHC domain containing 23 Gene [Source:MGI Symbol;Acc:MGI:2685625]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24490 Essential Splice Site Available for shipment Available now
sa3265 Essential Splice Site F2 line generated During 2018
sa37877 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24489 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010126 Essential Splice Site 46 425 2 5
Genomic Location (Zv9):
Chromosome 24 (position 21738957)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20986086
GRCz11 24 21130505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGGCATGTTGCTGTGACTGTGAGGATTTGGATGAGGCTTGTGACAG[G/A]TGAGTGAAAAAAATCTAACTGTGGGTTAAAGTATTTATATTTACATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3265
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010126 Essential Splice Site 279 425 4 5
Genomic Location (Zv9):
Chromosome 24 (position 21734808)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20981937
GRCz11 24 21126356
KASP Assay ID:
554-2959.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCCTGTGTGTAAGTGATCTGTGTAAATGAAGCTCAGTGTCTGTTATC[A/T]GGATCAACAGTTGTGTYGGACTGGCCAATCACCGCACTTTCCTTCTGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010126 Essential Splice Site 335 425 4 5
Genomic Location (Zv9):
Chromosome 24 (position 21734638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTCTTGACTGCTCTCTTCTACTGTCCCGATGTCTACAGTCAATACAG[G/T]TGAAAAAACACACACACACAAACACAAACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010126 Nonsense 398 425 5 5
Genomic Location (Zv9):
Chromosome 24 (position 21731487)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20978616
GRCz11 24 21123035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTCAAAGGCGCCTCTGGGGTCTCATCGTCCACACCGGCCATTATTCC[A/T]GAGGCTTCTGGAGCAACTGGACTGAGTTCTTGACCATGACTGAAGATACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link