zgc:77294

Ensembl ID:
ENSDARG00000003872
ZFIN ID:
ZDB-GENE-030131-4044
Description:
Coiled-coil domain-containing protein 102A [Source:UniProtKB/Swiss-Prot;Acc:Q6NZW0]
Human Orthologue:
CCDC102A
Human Description:
coiled-coil domain containing 102A [Source:HGNC Symbol;Acc:28097]
Mouse Orthologue:
Ccdc102a
Mouse Description:
coiled-coil domain containing 102A Gene [Source:MGI Symbol;Acc:MGI:2686927]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9364 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17078 Nonsense Available for shipment Available now
sa2342 Nonsense F2 line generated During 2018
sa5420 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa9364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011324 Essential Splice Site 443 581 6 9
ENSDART00000135322 Essential Splice Site 443 581 5 8
Genomic Location (Zv9):
Chromosome 7 (position 30128872)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28521214
GRCz11 7 28792364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACACCGACCTCAAGACCATCCAGAGTGAGCTGTTTGAGAGGAACAAG[G/A]TGAGGGAAGGAGAACGCCRTCCACACAGCACAAATAATCMCAAACGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17078
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011324 Nonsense 512 581 8 9
ENSDART00000135322 Nonsense 512 581 7 8
Genomic Location (Zv9):
Chromosome 7 (position 30159482)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28551824
GRCz11 7 28822974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGCATTTGTTTCAGTTGGATGAGGCCCAYAATCAGACCAGAAAGCTA[C/T]AACGATCCCTGGATGAGCAGGTGGAGYAATCCGAGAATCTACAAGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2342
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011324 Nonsense 521 581 8 9
ENSDART00000135322 Nonsense 521 581 7 8
Genomic Location (Zv9):
Chromosome 7 (position 30159509)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28551851
GRCz11 7 28823001
KASP Assay ID:
554-2459.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATAATCAGACCAGAAAGCTACAACGATCCCTGGATGAGCAGGTGGAG[C/T]AATCCGAGAATCTACAAGTTCAGCTKGAACACCTACAATCCAGGTAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5420
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011324 Nonsense 540 581 9 9
ENSDART00000135322 Nonsense 540 581 8 8
Genomic Location (Zv9):
Chromosome 7 (position 30172501)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28564843
GRCz11 7 28835993
KASP Assay ID:
554-3502.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RATTATTTATAACAAAAAWTGTTTAAATTGTTTTTAGGCTAAGGCGTCAG[C/T]AGAACCCTGGYCTCTTTGGCAAAATGAGGACMTCAGCTTCATCACGTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link