
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tm9sf2
- Ensembl ID:
- ENSDARG00000003866
- ZFIN ID:
- ZDB-GENE-030131-6302
- Description:
- transmembrane 9 superfamily member 2 [Source:RefSeq peptide;Acc:NP_997893]
- Human Orthologue:
- TM9SF2
- Human Description:
- transmembrane 9 superfamily member 2 [Source:HGNC Symbol;Acc:11865]
- Mouse Orthologue:
- Tm9sf2
- Mouse Description:
- transmembrane 9 superfamily member 2 Gene [Source:MGI Symbol;Acc:MGI:1915309]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19513 | Essential Splice Site | Available for shipment | Available now |
sa18297 | Nonsense | Available for shipment | Available now |
sa32695 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa19513
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019743 | Essential Splice Site | 52 | 658 | 1 | 17 |
The following transcripts of ENSDARG00000003866 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 28743676)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 28994505 GRCz11 1 29798436 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTAAGAAAGAAGCGGGCGACAAAAACAGCGAAGTCCCAGACTGCAAGG[T/A]AAATATTCACATTTAGAAGTGTACTAAATTAGTTTGCTTAAACGTATGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18297
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019743 | Nonsense | 73 | 658 | 2 | 17 |
The following transcripts of ENSDARG00000003866 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 28746406)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 28997235 GRCz11 1 29801166 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCTTTGTGAACAGGCTGGATTCTGTGGAGTCAGTTTTACCCTATGAATA[T/A]ACTGCGTGAGTTTAACATGTTTGTCATTTTTTTGTTCATKCAACATTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32695
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000019743 | Nonsense | 327 | 658 | 9 | 17 |
The following transcripts of ENSDARG00000003866 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 28754532)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 29005361 GRCz11 1 29809292 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGAATGGTCGCTATGATCATGCTTCGAACACTTCATAAAGATATCGCT[C/T]GATACAACCAGATGGACTCTGTGGTGAGTTCCACTCTACAAGATTACATC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: