zgc:101071

Ensembl ID:
ENSDARG00000003854
ZFIN IDs:
ZDB-GENE-040801-88, ZDB-GENE-040801-88
Description:
acyl-CoA synthetase long-chain family member 1 [Source:RefSeq peptide;Acc:NP_001003569]
Human Orthologue:
ACSL1
Human Description:
acyl-CoA synthetase long-chain family member 1 [Source:HGNC Symbol;Acc:3569]
Mouse Orthologue:
Acsl1
Mouse Description:
acyl-CoA synthetase long-chain family member 1 Gene [Source:MGI Symbol;Acc:MGI:102797]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14420 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010773 Nonsense 95 697 3 21
ENSDART00000130801 Nonsense 95 729 2 21
Genomic Location (Zv9):
Chromosome 14 (position 954929)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 938273
GRCz11 14 956537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCACTGTTGAGCTTCTACTATGAAGACGCCAAAACCATGTATGAGTG[T/A]TTCCACAGAGGCCTGAGGGAGTCAAGTATGTACACRCACACACRCACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link