wu:fc90d11

Ensembl ID:
ENSDARG00000003836
ZFIN ID:
ZDB-GENE-030131-4320
Human Orthologue:
TMEM63B
Human Description:
transmembrane protein 63B [Source:HGNC Symbol;Acc:17735]
Mouse Orthologue:
Tmem63b
Mouse Description:
transmembrane protein 63b Gene [Source:MGI Symbol;Acc:MGI:2387609]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24946 Nonsense Mutation detected in F1 DNA During 2018
sa15075 Nonsense Available for shipment Available now
sa42297 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11587 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004666 Nonsense 264 816 11 24
Genomic Location (Zv9):
Chromosome 13 (position 47276887)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46488149
GRCz11 13 46777984
KASP Assay ID:
554-7342.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTGTCTAACCTTTTTTCTCGTTTGTGTTGTTATTCAGGAAAGCATA[T/A]GAAAACTGTGTGGTTCTGGATGCTCGCATTTGTTACAATGTCGCCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004666 Nonsense 485 816 16 24
Genomic Location (Zv9):
Chromosome 13 (position 47264681)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46500355
GRCz11 13 46790190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCCAGAACCCCATCGTCACTCAGTTCTTCCCTACCCTGCTGTTGTG[G/A]TGCTTTTCGGCCCTCCTCCCTACCATCGTCTACTACTCCGCCTTTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004666 Essential Splice Site 704 816 22 24
Genomic Location (Zv9):
Chromosome 13 (position 47259424)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46505612
GRCz11 13 46795447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGTAATATGATTTTTCAATCTTGCTTGTCTTTTTTTCAATCTGACA[G/T]GATTTGGTGCTCCGACATCCATGTTTACTTTTGTGGTTCTGATCATCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004666 Nonsense 783 816 24 24
Genomic Location (Zv9):
Chromosome 13 (position 47258955)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46506081
GRCz11 13 46795916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGACGTACATTGCTCAAGTGCTACAGGACCCAAACTCAGAYGAGACC[G/T]GAAGTGACCAGGGTCAAGGGTCATCGCAGGACRAGGAAGGSGTGACCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link