Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-162b3.1
- Ensembl ID:
- ENSDARG00000003829
- ZFIN ID:
- ZDB-GENE-041111-110
- Description:
- polypeptide N-acetylgalactosaminyltransferase 2 [Source:RefSeq peptide;Acc:NP_001121823]
- Human Orthologue:
- GALNT2
- Human Description:
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) [Sour
- Mouse Orthologue:
- Galnt2
- Mouse Description:
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 Gene [Source:MGI
Alleles
There are 5 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa24933 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa17374 | Nonsense | Available for shipment | Available now |
| sa14540 | Essential Splice Site | Available for shipment | Available now |
| sa12860 | Nonsense | Available for shipment | Available now |
| sa28108 | Essential Splice Site, Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa24933
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000021360 | Nonsense | 21 | 565 | 1 | 16 |
| ENSDART00000136217 | Nonsense | 21 | 559 | 1 | 16 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24442455)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 24088115 GRCz11 13 24218565 - KASP Assay ID:
- 554-7488.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTAGGATGTATCTATGTTTCGCTGTGCTTTGGGTTCTGGGCATAGCTTA[T/G]TATTTCTATTCGGGAACAACGCTGAGTCGAAAGGTAGGTTTTTCTGTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17374
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000021360 | Nonsense | 35 | 565 | 2 | 16 |
| ENSDART00000136217 | Nonsense | 35 | 559 | 2 | 16 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24363923)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 24009583 GRCz11 13 24140033 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAAATGCCTTTTMTGCTCACAATCTGTTCTCCTCTTTGGCAGGATGACTG[G/A]AGTGGCATTAATTCAAACCGAATTCAAACACACAGYAATGCAGATGACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14540
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000021360 | Essential Splice Site | 290 | 565 | 9 | 16 |
| ENSDART00000136217 | Essential Splice Site | 290 | 559 | 9 | 16 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24310815)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 23956475 GRCz11 13 24086925 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCCTGGAACAAAGACRAGCTCGACAAGGAAACCCCATYGCTCCTATCAAG[T/A]AAGAAAGCAATCGTGAAWCTGCTGATGTGTAATTGTCAGCYGCTTTGSGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12860
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000021360 | Nonsense | 440 | 565 | 14 | 16 |
| ENSDART00000136217 | Nonsense | 440 | 559 | 14 | 16 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24298155)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 23943815 GRCz11 13 24074265 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTWGTTTAGAGTGCCGGAWCATCAGGACATTGCATTTGGAGCTCTTCAG[C/T]AGGGTCAAAACTGTCTGGACACACTGGGCCATTTTGCAGATGGTGTGGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28108
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site, Missense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000021360 | Missense | 469 | 565 | 14 | 16 |
| ENSDART00000136217 | Essential Splice Site | 468 | 559 | None | 16 |
- Genomic Location (Zv9):
- Chromosome 13 (position 24298067)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 23943727 GRCz11 13 24074177 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGATGGTGTGGTGGGGGTTTACGAGTGCCACAACGCTGGGGGCAATCAGG[T/A]ATCAAACAAAACGCAGGTACTCAACAGTCTTCTAATGTCTGGTGCAGAGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Hematology traits: Genome-wide association study of serum albumin:globulin ratio in Korean populations. (View Study)
- Metabolic syndrome: Genome-wide screen for metabolic syndrome susceptibility Loci reveals strong lipid gene contribution but no evidence for common genetic basis for clustering of metabolic syndrome traits. (View Study)
- Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
- Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
- Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
- Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
- Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
- Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
