srp54

Ensembl ID:
ENSDARG00000003813
ZFIN ID:
ZDB-GENE-040426-818
Description:
signal recognition particle 54 kDa protein [Source:RefSeq peptide;Acc:NP_957282]
Human Orthologue:
SRP54
Human Description:
signal recognition particle 54kDa [Source:HGNC Symbol;Acc:11301]
Mouse Orthologues:
Srp54a, Srp54b, Srp54c
Mouse Descriptions:
signal recognition particle 54A Gene [Source:MGI Symbol;Acc:MGI:1346087]
signal recognition particle 54B Gene [Source:MGI Symbol;Acc:MGI:3714357]
signal recognition particle 54C Gene [Source:MGI Symbol;Acc:MGI:3714359]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11820 Nonsense Available for shipment Available now
sa36339 Nonsense Available for shipment Available now
sa421 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018678 Nonsense 14 504 3 18
ENSDART00000133424 Nonsense 14 504 3 17

The following transcripts of ENSDARG00000003813 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10525136)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9920188
GRCz11 17 10076222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGCAAAAATGGTTTTAGCTGATCTGGGGAGGAAAATAACCTCAGCTT[T/A]GAGGTCTCTCAGCAATGCCACCATCATCAATGAGGAGGTACAGATGYAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018678 Nonsense 219 504 10 18
ENSDART00000133424 Nonsense 219 504 10 17

The following transcripts of ENSDARG00000003813 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10520629)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9924695
GRCz11 17 10080729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCTTCATAAGTCATGTGTGTCCCACAGCAACCTGACAATATAGTGTA[C/G]GTGATGGACGCCTCCATTGGTCAGGCTTGCGAGGCTCAAGCTAAGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018678 Essential Splice Site None 504 18 18
ENSDART00000133424   None 504 17 17

The following transcripts of ENSDARG00000003813 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 10511645)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9933679
GRCz11 17 10089713
KASP Assay ID:
554-0318.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAGTGATCAGCTTGGCAAATACACACACACACACACACACACACACA[C/T]ACACACACACACACACACACACACACACAGAGACGTCTGGATCTGAGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link