
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_571883.1
- Ensembl ID:
- ENSDARG00000003783
- Description:
- ephrin B2b [Source:RefSeq peptide;Acc:NP_571883]
- Human Orthologue:
- EFNB2
- Human Description:
- ephrin-B2 [Source:HGNC Symbol;Acc:3227]
- Mouse Orthologue:
- Efnb2
- Mouse Description:
- ephrin B2 Gene [Source:MGI Symbol;Acc:MGI:105097]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
hu2971 | Nonsense | Confirmed mutation in F2 line | Unknown |
sa25519 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- hu2971
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Unknown
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023180 | Nonsense | 78 | 334 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 6783557)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 6966774 GRCz11 1 7650207 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAAGCCAGGCTCCACTGAGCAGACGAACATTGAATACTTCCGGGTCTA[T/A]CTTGTTCCCAAAGAACAACTCGAGACCTGCCATGTTACTAAAAGCGACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25519
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000023180 | Nonsense | 131 | 334 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 1 (position 6783716)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 6966615 GRCz11 1 7650048 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGTTCAGCCCCAACCTGTGGGGCCTGGAGTTCTTAAGAGGGAAGGACTA[T/G]CACATCATCTGTAAGTTTATTGCCACTCTCATTCAAGAATTTACCTCAGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: