tada2b

Ensembl ID:
ENSDARG00000003769
ZFIN ID:
ZDB-GENE-050522-557
Description:
Transcriptional adapter 2-beta [Source:UniProtKB/Swiss-Prot;Acc:Q503N9]
Human Orthologue:
TADA2B
Human Description:
transcriptional adaptor 2B [Source:HGNC Symbol;Acc:30781]
Mouse Orthologue:
Tada2b
Mouse Description:
transcriptional adaptor 2B Gene [Source:MGI Symbol;Acc:MGI:3035274]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34134 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40969 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004365 Essential Splice Site 90 486 1 2
Genomic Location (Zv9):
Chromosome 7 (position 41131567)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39467824
GRCz11 7 39738841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGCAGTCGCTGCTCGATGCCATCGAGCAATATGGATTTGGAAATTGG[G/A]TACGACTCTCAAAATAATTACACATGGATGCAGCTCATAAAAAGCTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004365 Nonsense 422 486 2 2
Genomic Location (Zv9):
Chromosome 7 (position 41134005)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39470262
GRCz11 7 39741279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGCTATTGAGAACCTGTCCGGATTTGAGCTGCTATCCGATAGGGAG[A/T]AAGTACTGTGCAACTCCATGAACCTCAGTCCCATGCGTTATCTGACAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link