zgc:92683

Ensembl ID:
ENSDARG00000003642
ZFIN ID:
ZDB-GENE-040718-109
Description:
zinc finger FYVE domain-containing protein 19 [Source:RefSeq peptide;Acc:NP_001002412]
Human Orthologue:
ZFYVE19
Human Description:
zinc finger, FYVE domain containing 19 [Source:HGNC Symbol;Acc:20758]
Mouse Orthologue:
Zfyve19
Mouse Description:
zinc finger, FYVE domain containing 19 Gene [Source:MGI Symbol;Acc:MGI:1919258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22972 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013093 Nonsense 89 404 4 12
Genomic Location (Zv9):
Chromosome 17 (position 1503415)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1946364
GRCz11 17 2123177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTCTCTTACAGACGAGTTGCTGCTTTTGAAGCCAAACAAGCTCAA[C/T]AGAAACCGTCATCCAGAGCGGCAGGAGCAAAAGACAACGCCGTGAGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link