Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tfg
- Ensembl ID:
- ENSDARG00000003641
- ZFIN ID:
- ZDB-GENE-030131-8410
- Description:
- protein TFG [Source:RefSeq peptide;Acc:NP_956309]
- Human Orthologue:
- TFG
- Human Description:
- TRK-fused gene [Source:HGNC Symbol;Acc:11758]
- Mouse Orthologue:
- Tfg
- Mouse Description:
- Trk-fused gene Gene [Source:MGI Symbol;Acc:MGI:1338041]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa31722 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31722
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013591 | Nonsense | 388 | 396 | 8 | 8 |
| ENSDART00000112398 | Nonsense | 388 | 396 | 8 | 9 |
- Genomic Location (Zv9):
- Chromosome 9 (position 31161495)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 30317441 GRCz11 9 30128187 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGGGTGCCAATCCCTATGCCCGAAACCGCCCGCCTTACGGCCAGGGCTA[C/A]ACCCAACCAGGTCCTGGCTATCGGTAAAAGCCCTTTAACATCCCTACAGC
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
