tfg

Ensembl ID:
ENSDARG00000003641
ZFIN ID:
ZDB-GENE-030131-8410
Description:
protein TFG [Source:RefSeq peptide;Acc:NP_956309]
Human Orthologue:
TFG
Human Description:
TRK-fused gene [Source:HGNC Symbol;Acc:11758]
Mouse Orthologue:
Tfg
Mouse Description:
Trk-fused gene Gene [Source:MGI Symbol;Acc:MGI:1338041]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31722 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013591 Nonsense 388 396 8 8
ENSDART00000112398 Nonsense 388 396 8 9
Genomic Location (Zv9):
Chromosome 9 (position 31161495)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30317441
GRCz11 9 30128187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGTGCCAATCCCTATGCCCGAAACCGCCCGCCTTACGGCCAGGGCTA[C/A]ACCCAACCAGGTCCTGGCTATCGGTAAAAGCCCTTTAACATCCCTACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link