zgc:101757

Ensembl ID:
ENSDARG00000003635
ZFIN ID:
ZDB-GENE-041212-51
Description:
diacylglycerol O-acyltransferase 2 [Source:RefSeq peptide;Acc:NP_001008626]
Human Orthologue:
MOGAT3
Human Description:
monoacylglycerol O-acyltransferase 3 [Source:HGNC Symbol;Acc:23249]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5744 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa5744
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015136 Nonsense 218 336 6 8
ENSDART00000015136 Nonsense 218 336 6 8
Genomic Location (Zv9):
Chromosome 5 (position 40201378)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 38000768
GRCz11 5 38600921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTACAGGAGTAAACACTGTGGTCATAAAACACAGGAAAGGCTTTGTA[C/T]GACTGGCTCTTGAACACGGGTGAGAAAGAGACRAGAAKAAGATAAAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link