arih1

Ensembl ID:
ENSDARG00000003616
ZFIN ID:
ZDB-GENE-030131-5213
Description:
ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 [Source:RefSeq peptide;Acc:NP_956
Human Orthologue:
ARIH1
Human Description:
ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) [Source:HGNC Symbol
Mouse Orthologue:
Arih1
Mouse Description:
ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila) Gene [Source:MGI Symb

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43081 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019581 Nonsense 226 527 6 14
Genomic Location (Zv9):
Chromosome 18 (position 18669760)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18899983
GRCz11 18 18889049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTCCGTTCTTTTCACAGGAGACTGATTACAGATTCAAAAGTGAAGT[T/A]GAAGTACCAGCATTTAATAACCAATAGTTTTGTAGAGGTAATACTTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link