
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gnrhr2
- Ensembl ID:
- ENSDARG00000003553
- ZFIN ID:
- ZDB-GENE-090128-3
- Description:
- gonadotropin releasing hormone receptor 2 [Source:RefSeq peptide;Acc:NP_001138451]
- Human Orthologue:
- GNRHR
- Human Description:
- gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
- Mouse Orthologue:
- Gnrhr
- Mouse Description:
- gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31599 | Nonsense | Available for shipment | Available now |
sa41021 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31599
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006795 | Nonsense | 162 | 412 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 7 (position 53820312)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 52090162 GRCz11 7 52365232 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATCCTCAACCCTCTGTCCATCAACAAGGCGATGAGAAGAAATAAAGTTT[T/A]GCTGGGCGTCGCGTGGACCATGAGTGTCGTGTTGTCCATACCGCAGGTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41021
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006795 | Essential Splice Site | 177 | 412 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 7 (position 53820360)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 52090210 GRCz11 7 52365280 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGCTGGGCGTCGCGTGGACCATGAGTGTCGTGTTGTCCATACCGCAGG[T/A]AAATAAACAGAGGCGCACAGATGAGAAGTTTGGGTTGGGTGAGATGTATA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: