zgc:85716

Ensembl ID:
ENSDARG00000003513
ZFIN ID:
ZDB-GENE-040516-9
Description:
thyroid hormone receptor-associated protein 3 [Source:RefSeq peptide;Acc:NP_999980]
Human Orthologue:
THRAP3
Human Description:
thyroid hormone receptor associated protein 3 [Source:HGNC Symbol;Acc:22964]
Mouse Orthologue:
Thrap3
Mouse Description:
thyroid hormone receptor associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:2442637]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1741 Essential Splice Site Available for shipment Available now
sa8637 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023747 Essential Splice Site 549 880 5 11
Genomic Location (Zv9):
Chromosome 19 (position 4667990)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3941551
GRCz11 19 3872377
KASP Assay ID:
554-1686.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAGCTRTTTGCTCAACACATAGTGACCATAGTACATCAYATTAAAGG[T/C]AAATCCAGTCTAATCTGATAGTTTTAAGCTATKCATCATTAATGCTGCAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa8637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023747 Essential Splice Site 805 880 10 11
Genomic Location (Zv9):
Chromosome 19 (position 4662038)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3935700
GRCz11 19 3866648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGGAGTGGGACCCTGAATACACCCCYAAAAGTCGAAAATACTTCCAG[G/A]TGTGCTAGCATTCATCTCCCCTCTTAAACGGCATGTAAAAACTGGTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link